View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14173_high_12 (Length: 203)
Name: NF14173_high_12
Description: NF14173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14173_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 45177209 - 45177040
Alignment:
| Q |
17 |
atatggtcttatatttggtctgcattttctgtcattttcagttctccatccattcattttgatcatattgattgataccaagtgttaattcataggagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45177209 |
atatggtcttatatttggtctgcattttctgtcattttcagttctccatccattcattttgatcatattgattgataccaagtgttaattcataggagta |
45177110 |
T |
|
| Q |
117 |
acttctttctggttcaactcttgtgttactttttggaatttccttacctaatgtaaaaaagcgaaaaatc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45177109 |
acttctttctggttcaactcttgtgttactttttggaatttccttacctaatgtaaaaaagctaaaaatc |
45177040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University