View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14174_low_2 (Length: 426)
Name: NF14174_low_2
Description: NF14174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14174_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 147 - 420
Target Start/End: Original strand, 2056747 - 2057021
Alignment:
| Q |
147 |
tgaaaggcaaaggggaatggttgaagaatttgcatctttggaagcaaatgacacttgatcttcatgcatattccccctagaaaacgcgttgtaggttgca |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2056747 |
tgaaaggcaaaggggaatggttgaagaatttgcatctttggaagcaaatgacacttgatcttcatgcatattccccctagaaaacgcgttgtaggttgca |
2056846 |
T |
 |
| Q |
247 |
aatgggtatatgcaaggagagacttgtcgctcaagggttatctcaacaacagtatggtatagattttctagacactttttcatttgtggcaaag-ttaac |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2056847 |
aatgggtatatgcaaggagagacttgtcgctcaagggttatctcaacaacagtatggtatagattttctagacactttttcatttgtggcaaagtttaac |
2056946 |
T |
 |
| Q |
346 |
atctgtttggattctcctctcattgccttctcagtgaactcagtgaggaattggtatatgactctacctcacttc |
420 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2056947 |
atctgtttggattctcctctcattgccttctcagtgaactcagtgaggaattggtatatgactctacctcacttc |
2057021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 2056586 - 2056703
Alignment:
| Q |
1 |
tttttaagtttttcctcgtagtgaagtacaaattgta-----------acatgttttttcgcaggccggtcctcaaggatacataaaccttcatgcacat |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2056586 |
tttttaagtttttcctcgtagtgaagtacaaattgtagacctttcccaacatgttttttcgcaggccggtcctcaaggatacataaaccttcatgcacat |
2056685 |
T |
 |
| Q |
90 |
ttacttatgattatctat |
107 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2056686 |
ttacttatgattatctat |
2056703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University