View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14174_low_9 (Length: 209)
Name: NF14174_low_9
Description: NF14174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14174_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 15202546 - 15202721
Alignment:
| Q |
20 |
cgagtcacaacgcaatttggttaaacggggaatttatcctttctgagaacgttttctcaatactggttcagtgacagcaaaagcaagagccgcagcactc |
119 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15202546 |
cgagtcacagcgcgatttggttaaacggggaatttatcctttgtgagaacgttttctcaatactggttcagtgacagcaaaagcaagagccgcagcactc |
15202645 |
T |
|
| Q |
120 |
tggtgatctttccatgagcactccaaagctcacagttatttcggaagttattggttttcagaatcaacgcctatga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| | |||||||| |
|
|
| T |
15202646 |
tggtgatctttccatgagcactccaaagctcacagttgtttcagaagttattggttttcagaatctaagcctatga |
15202721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 22 - 195
Target Start/End: Original strand, 15213450 - 15213625
Alignment:
| Q |
22 |
agtcacaacgcaatttggttaaacggggaatttatcctttctgagaacgttttctcaatactggttcagtgacagcaaaagcaagagccgcagcactc-- |
119 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||||| |||||| | || |||||||||||||||||| ||||||||||||||||||||| | |||| || |
|
|
| T |
15213450 |
agtcacagcgcgatttggctaaacggggaatttattctttcttacaatgttttctcaatactggttaagtgacagcaaaagcaagagcagtagcattcat |
15213549 |
T |
|
| Q |
120 |
tggtgatctttccatgagcactccaaagctcacagttatttcggaagttattggttttcagaatcaacgcctatga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||| | |||||||| |
|
|
| T |
15213550 |
cggtgatctttccatgagcactccaaagctcacagttgtttcagaagttattggttgtcagaatctaagcctatga |
15213625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 161
Target Start/End: Original strand, 34036238 - 34036381
Alignment:
| Q |
20 |
cgagtcacaacgcaatttggttaaacggggaatttatcctttctgagaacgttttctcaatactggttcagtgacagcaaaagcaagagccgcagcactc |
119 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||| |||||||| | |||||||||||| |||||||| || ||||| |||| || ||||| || |
|
|
| T |
34036238 |
cgagtcacaacgcgatttggttaaacgtggaatatatcctttgcttgttgattttctcaatacaggttcagtcactgcaaaggcaattgcagcagctttc |
34036337 |
T |
|
| Q |
120 |
--tggtgatctttccatgagcactccaaagctcacagttatttc |
161 |
Q |
| |
|
|| |||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
34036338 |
atcggagatctttctatgagcacgccaaagctcacagttatttc |
34036381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University