View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14175_high_9 (Length: 227)

Name: NF14175_high_9
Description: NF14175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14175_high_9
NF14175_high_9
[»] chr8 (1 HSPs)
chr8 (4-116)||(43102705-43102819)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 43102819 - 43102705
Alignment:
4 cctctctgttcacaagccttcggagcaaac-gtcctaaactcc-atcattaacccttcaacgttgcatcctcttcttatagctatgttccattcccattc 101  Q
    |||||||||||||||||||||||||||||| |||||||||||| ||| ||||| ||||||||||||||||||||| |||  ||||||||||||||||||     
43102819 cctctctgttcacaagccttcggagcaaaccgtcctaaactcctatccttaacacttcaacgttgcatcctcttcctattactatgttccattcccattt 43102720  T
102 acttcatgtggctta 116  Q
     ||||||||||||||    
43102719 ccttcatgtggctta 43102705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University