View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14175_low_14 (Length: 227)
Name: NF14175_low_14
Description: NF14175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14175_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 4 - 116
Target Start/End: Complemental strand, 43102819 - 43102705
Alignment:
| Q |
4 |
cctctctgttcacaagccttcggagcaaac-gtcctaaactcc-atcattaacccttcaacgttgcatcctcttcttatagctatgttccattcccattc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||| ||||| ||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
43102819 |
cctctctgttcacaagccttcggagcaaaccgtcctaaactcctatccttaacacttcaacgttgcatcctcttcctattactatgttccattcccattt |
43102720 |
T |
 |
| Q |
102 |
acttcatgtggctta |
116 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43102719 |
ccttcatgtggctta |
43102705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University