View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14176_high_13 (Length: 276)
Name: NF14176_high_13
Description: NF14176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14176_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 22 - 259
Target Start/End: Complemental strand, 40509730 - 40509493
Alignment:
| Q |
22 |
cgccttgcgttcaagatgtctctatggagccttgttttcatatacctcctaaacatgattgcaaggaaaaacccttggatgatattggcacaacttttcc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40509730 |
cgccttgcgttcaagatgtctctatggagccttgttttcatatacctcctaaacatgattgcaaggaaaaacccttggatgatattggcacaacttttcc |
40509631 |
T |
 |
| Q |
122 |
atacatgaggagatgtgtggattttggatcgggtataaagttgatcaatgatcttcagtagctattaacaactttttctttgaaagattttaattgtagt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40509630 |
atacatgaggagatgtgtggattttggatcgggtataaagttgatcaatgatcttcagtagctattaacaactttttctttgaaagattttaattgtagt |
40509531 |
T |
 |
| Q |
222 |
ttattgtgaccgcacaactattttcgactatcatttag |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40509530 |
ttatggtgaccgcacaactattttcgactatcatttag |
40509493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University