View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14176_high_16 (Length: 243)
Name: NF14176_high_16
Description: NF14176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14176_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 226
Target Start/End: Original strand, 49043533 - 49043747
Alignment:
| Q |
12 |
aaaaagttattcccatttttgtgggtgtcgtgcagcagttggcaagacaatagggaaatgggcagattgatgggaaggctggtggttgttgttggctggt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49043533 |
aaaaagttattcccatttttgtgggtgtcgtgcagcagttggcaagacaatagggaaatgggcagattgatgggaaggctggtggttgttgttggctggt |
49043632 |
T |
 |
| Q |
112 |
catcaaggaacaataaatggtattgtgtggtaggtttgttcacatatttgaatttgacaaagtcttaaacccaatttttaaagtatgatcagttttgtgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49043633 |
catcaaggaacaataaatggtattgtgtggtaggtttgttcacatatttgaatttgacaaagtcttaaacccaatttttaaagtatgatcagttttgtgt |
49043732 |
T |
 |
| Q |
212 |
tatatcaatcatgtg |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49043733 |
tatatcaatcatgtg |
49043747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University