View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14176_low_12 (Length: 298)
Name: NF14176_low_12
Description: NF14176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14176_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 28 - 285
Target Start/End: Original strand, 28434033 - 28434290
Alignment:
| Q |
28 |
aaatcataatggacattgatttccgttggggtggtgatcctaatattgttttgggcgttgaagcacttgttgcgtcaattcctattcaggttagactaag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28434033 |
aaatcataatggacattgatttccgttggggtggtgatcctaatattgttttgggcgttgaagcacttgttgcgtcaattcctattcaggttagactaag |
28434132 |
T |
 |
| Q |
128 |
ctgtgtttctatattgcatttcatgtcactgaggcattttcaaaattttgattgttattgtttctcgcttcagttgaaggatctccaggttttcaccatt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28434133 |
ctgtgtttctatattgcatttcatgtcactgaggcattttcaaaattttgattgttattgtttctcgcttcagttgaaggatctccaggttttcaccatt |
28434232 |
T |
 |
| Q |
228 |
atccgtgttatattccaactcgcagaagagatcccctgcatttctgctgttgttgttg |
285 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28434233 |
atccgtgtcatattccaactcgcagaagagatcccctgcatttctgctgttgttgttg |
28434290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 194 - 285
Target Start/End: Complemental strand, 12971041 - 12970950
Alignment:
| Q |
194 |
gcttcagttgaaggatctccaggttttcaccattatccgtgttatattccaactcgcagaagagatcccctgcatttctgctgttgttgttg |
285 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||||||||||||| || ||||||||||| |||||||||||||||||||||| |
|
|
| T |
12971041 |
gcttcagttgaaggatctaaaagttttcaccattgcccgtgttatattccaacttgctgaagagatcccttgcatttctgctgttgttgttg |
12970950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University