View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_high_23 (Length: 425)
Name: NF14177_high_23
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 15 - 66
Target Start/End: Original strand, 25325718 - 25325771
Alignment:
| Q |
15 |
aatattgattaggctatttttgtttttggtggaaaatgtaa--catgtattgtt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
25325718 |
aatattgattaggctatttttgtttttggtggaaaatataattcatgtattgtt |
25325771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University