View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14177_high_23 (Length: 425)

Name: NF14177_high_23
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14177_high_23
NF14177_high_23
[»] chr7 (1 HSPs)
chr7 (15-66)||(25325718-25325771)


Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 15 - 66
Target Start/End: Original strand, 25325718 - 25325771
Alignment:
15 aatattgattaggctatttttgtttttggtggaaaatgtaa--catgtattgtt 66  Q
    ||||||||||||||||||||||||||||||||||||| |||  |||||||||||    
25325718 aatattgattaggctatttttgtttttggtggaaaatataattcatgtattgtt 25325771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University