View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_high_43 (Length: 323)
Name: NF14177_high_43
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_high_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 26 - 192
Target Start/End: Original strand, 14988421 - 14988587
Alignment:
| Q |
26 |
tgttggtctatatattttgagattagttataggcttataggatttaattgatatattcgtagcgagggtaatgatcgatcatattcattagatcattaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14988421 |
tgttggtctatatattttgagattagttataggcttataggatttaattgatatattcgtagcgagggtaatgatcgatcatattcattagatcattaaa |
14988520 |
T |
 |
| Q |
126 |
actgtttgattttcatgataattaattttaaagtcatacatatgattaattttgatttgttgacgct |
192 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14988521 |
aatgtttgattttcatgataattaattttaaagtcgcacatatgattaattttgatttgttgacgct |
14988587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 257 - 311
Target Start/End: Original strand, 14988591 - 14988645
Alignment:
| Q |
257 |
ctggtatgttgctttgatgatagaatcggttggttcatccgttgcttgatatttt |
311 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14988591 |
ctggtatgttgctttgatgatagaattggttggttcatccgttgcttgatatttt |
14988645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University