View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_high_65 (Length: 228)
Name: NF14177_high_65
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_high_65 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 49; Significance: 4e-19; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 19422748 - 19422677
Alignment:
| Q |
1 |
tattcactccaggtcctgtgatgtcaggctgcattgtttgataagcaaaaatatatttaaatataagtatagg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||| |||| |||||||| |
|
|
| T |
19422748 |
tattcactccaggtcctgtgatgtcaggctgcatttttttataagcaaaaa-atatttacatattagtatagg |
19422677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 19430000 - 19429957
Alignment:
| Q |
1 |
tattcactccaggtcctgtgatgtcaggctgcattgtttgataa |
44 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
19430000 |
tatttactccaggtcctgttatgtcaggctgcattgttggataa |
19429957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 112 - 180
Target Start/End: Complemental strand, 35743386 - 35743318
Alignment:
| Q |
112 |
tataagcacttgtgagattatttggaagaacttatggcttgtttgtatgttgttttcaacttatttcca |
180 |
Q |
| |
|
|||||||| |||||||| | ||| ||||| |||||| | ||||| || ||||||| ||||||||||||| |
|
|
| T |
35743386 |
tataagcatttgtgagactgtttagaagagcttatgacatgtttataagttgtttccaacttatttcca |
35743318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 152
Target Start/End: Complemental strand, 36189748 - 36189706
Alignment:
| Q |
110 |
agtataagcacttgtgagattatttggaagaacttatggcttg |
152 |
Q |
| |
|
||||||||||||||||||| | |||||| |||||||||||||| |
|
|
| T |
36189748 |
agtataagcacttgtgagactgtttggaggaacttatggcttg |
36189706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 146
Target Start/End: Original strand, 44928142 - 44928178
Alignment:
| Q |
110 |
agtataagcacttgtgagattatttggaagaacttat |
146 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
44928142 |
agtataagcacttgtaagattgtttggaagaacttat |
44928178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University