View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_44 (Length: 336)
Name: NF14177_low_44
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 97 - 322
Target Start/End: Original strand, 45090228 - 45090453
Alignment:
| Q |
97 |
tatgcaaataaaatttgattattttggcttggaatcttatgtggtgattatgatgtttaggaggctagaagctgatcgtttcttcacaacaaatttcaac |
196 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45090228 |
tatgaaaataaaatttgattattttggtttggaatcttatgtggtgattatgatgtttaggaggctagaagctgatcgtttcttcacaacaaatttcaac |
45090327 |
T |
 |
| Q |
197 |
tcaaaaacatacacaaaccaaggttttgaatgggtaaacaaaacagagtctttgaaggatgtgattgacaggcacttccctgatatgactaaaaattgga |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45090328 |
tcaaaaacatacacaaaccaaggttttgaatgggtaaacaaaacagagtctttgaaggatgtgattgacaggcacttccctgagatgactaaaaattgga |
45090427 |
T |
 |
| Q |
297 |
tgacaagctcaagtgcattctctgtg |
322 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45090428 |
tgacaagctcaagtgcattctctgtg |
45090453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 17 - 73
Target Start/End: Original strand, 45090160 - 45090216
Alignment:
| Q |
17 |
aagtgagactgctttctttatctttgtgatcatggcttcaaggtaagttttaagcac |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45090160 |
aagtgagactgctttctttatctttgtgatcatggcttcaaggtaagttttaagcac |
45090216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University