View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_46 (Length: 330)
Name: NF14177_low_46
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 306
Target Start/End: Original strand, 4318414 - 4318721
Alignment:
| Q |
1 |
tattctatggtatattctctgtctcttttcttcatcatgatttaggtcatttagacgcgctataagattaatcattgagtaagttacacgacatttatcn |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
4318414 |
tattctatggtatattctttgtctcttttcttcatcatgatttaggtcatttagacgcgctataagattaatcattaagtaagctacacgacatttatct |
4318513 |
T |
 |
| Q |
101 |
nnnnnnnngttttgtttggattagaccgtcttcaaatgctacgtttggttttgcggttggtcattgtagtcgcacgtttagtgttcgattttttgtggaa |
200 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
4318514 |
tatttttctttttgtttgggttggaccgtcttcaaatgctacgtttgattttgcggttggtcattgtagtcgcacgtttagtgttccattttttgtgaaa |
4318613 |
T |
 |
| Q |
201 |
caagaagctagtaatagtagttttacaaaatacgtgtgtctactaggctctttgatgtggaaacaaacaa--ataactttaagaaatgaatccaagttcc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4318614 |
caagaagctagtaatagtagttttacaaaagacgtgtgtctactaggctctttgatgtggaaacaaacaaagataactttaagaaatgaatccaagttcc |
4318713 |
T |
 |
| Q |
299 |
tttagtaa |
306 |
Q |
| |
|
|||||||| |
|
|
| T |
4318714 |
tttagtaa |
4318721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University