View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_54 (Length: 307)
Name: NF14177_low_54
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 288
Target Start/End: Original strand, 7008114 - 7008386
Alignment:
| Q |
16 |
agatgaataattgatcttatacgtttggctagtcataagagaaaagaagtccataatttaatttgtcctaagccaaaatgactaggatgcacacaatttc |
115 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7008114 |
agatgaataatatatcttatacgtttggttagtcataagagaaaagaagtccataatttaatttgtcctaagccaaaatgactaggatgcacacaatttc |
7008213 |
T |
 |
| Q |
116 |
ttgttattctatttgagtaatattttgcactcatgttgtggggaagcaatgaacatccccgaccaagtatgaatgaatggtgtgaaactttaaacagaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7008214 |
ttgttattctatttgagtaatattttgcactcatgttgtggggaagcaatgaacatccccgaccaagtatgaatgaatggtgtgaaactttaaacagaat |
7008313 |
T |
 |
| Q |
216 |
agtttaataaaacaagaaaattaatgttaacattgtcgtacactcataacctatgaagcacagacacagacac |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7008314 |
agtttaataaaacaagaaaattaatgttaatattgtcgtacactcataacctatgaagcacagacacagacac |
7008386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University