View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_58 (Length: 293)
Name: NF14177_low_58
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_58 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 24 - 283
Target Start/End: Complemental strand, 2802648 - 2802389
Alignment:
| Q |
24 |
agaatcacctaatctaatgtacaaggtgcttgcatgccaatgctatagtaagtgttatcaaaattcaaatcatattattcattctttcacatactttttc |
123 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2802648 |
agaatcacctaatctaatgtaaaaggtgcttgcacgccaatgctatagtaagtgttatcaaaattcaaatcatattattcattctttcacataatttttc |
2802549 |
T |
|
| Q |
124 |
tttttatattcataactttatgatatcctaatgttaaaatatttccacccaagttttgaagatgaacaagaacaatgacattttttaaatcaccttgcaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2802548 |
tttttatattcataactttatgatatcctaatgttaaaatatttccacccaagttttgaagatgaacaagaacaatgacattttttaaatcaccttgcaa |
2802449 |
T |
|
| Q |
224 |
agattatagattggtgattgtgatgttgtctattatataattgagtgattatggcctttg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2802448 |
agattatagattggtgattgtgatgttgtctattatataattgagtgattatggcctttg |
2802389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University