View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_62 (Length: 288)
Name: NF14177_low_62
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 18 - 282
Target Start/End: Complemental strand, 47395659 - 47395395
Alignment:
| Q |
18 |
ttcttgggatcatgctggttttgttagggtttatgcaatgtatcttgatcaaaaggttgaatttttggtttataagaagaaattgaaaggtgttgttgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47395659 |
ttcttgggatcatgctggttttgttagggtttatgcaatgtatcttgatcaaaaggttgaatttttggtttataataagaaattgaaaggtgttgttgat |
47395560 |
T |
|
| Q |
118 |
tctggggatggtgaatttggttctgtgaagaggaatgaggagaagagtgatgttacccctgtgagggaaatgaaagctgagagggttttggataggttga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47395559 |
tctggggatggtgaatttggttctgtgaagaggaatgaggagaagagtgatgttacccctgtgagggaaatgaaagctgagagggttttggataggttga |
47395460 |
T |
|
| Q |
218 |
agcatttgcttcaaattctcgacagtgtattaggttgtaaaccacatggtgctgctaagaataat |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47395459 |
agcatttgcttcaaattctcgacagtgtattaggttgtaaaccacatggtgctgctaagaataat |
47395395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 19 - 179
Target Start/End: Original strand, 47835139 - 47835297
Alignment:
| Q |
19 |
tcttgggatcatgctggttttgttagggt--ttatgcaatgtatcttgatcaaaaggttgaatttttggtttataagaagaaattgaaaggtgttgttga |
116 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47835139 |
tcttgggatcatgctggttttgttaggctaattatgcaatgtatcttgatcaaaaggttgaatttttggtttat---aagaaattgaaaggtgttgaaac |
47835235 |
T |
|
| Q |
117 |
ttctggggatggtgaatttggttctgtgaagaggaatgaggagaagagtgatgttacccctgt |
179 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
47835236 |
atctcgggatgctgaatttggttctgtgaagaggaatga-gagaagagtgaggttacccctgt |
47835297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University