View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_72 (Length: 237)
Name: NF14177_low_72
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 9750272 - 9750097
Alignment:
| Q |
15 |
tgccatcttcaaccaatagtagagaaactatcggcttggaaggcatcattgctttcaattgcaggaagagtacaagtgccaaagtctgtggttactagaa |
114 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9750272 |
tgccatgttcaaccaatagcagagtaactatcggcttggaaggcatcattgctttcaattgcaggaagagtacaagtgccaaagtctgtggttactagaa |
9750173 |
T |
 |
| Q |
115 |
tgctagctcatacattatctatttattcatggcttatttctctcttgaagggtacggaaaaatgcatcatctacttt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
9750172 |
tgctagctcatacattatctatttattcatggcttatttctctcttgaagggcatgg-aaaatgcatcatctacttt |
9750097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 48 - 85
Target Start/End: Complemental strand, 16920609 - 16920572
Alignment:
| Q |
48 |
gcttggaaggcatcattgctttcaattgcaggaagagt |
85 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
16920609 |
gcttggaaagcatcattgctttctattgcaggaagagt |
16920572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University