View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14177_low_74 (Length: 226)
Name: NF14177_low_74
Description: NF14177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14177_low_74 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 44985978 - 44986197
Alignment:
| Q |
7 |
attcatagccccataatcaaacttggtcttcaacatgacttgtatttaaccaacaatttactctctttatatgctaaaacctttggagttcatcgagcac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44985978 |
attcatagccccataatcaaacttggtcttcaacatgacttgtatttaaccaacaatttactctctttatatgctaaaacctttggagttcatcgagcac |
44986077 |
T |
|
| Q |
107 |
gccacttgttcgatgaaatgcctaacagagacgtcgtatcatggacaacgattctgtcttcacacaccaagactaagcatcattctgatgccctgcagtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44986078 |
gccacttgttcgatgaaatgcctaacagagacgtcgtatcatggacaacgattctgtcttcacacaccaagactaagcatcattctgatgccctgcagtt |
44986177 |
T |
|
| Q |
207 |
gtttgatatgatgataggtt |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
44986178 |
gtttgatatgatgataggtt |
44986197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University