View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_26 (Length: 347)
Name: NF14178_high_26
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 2 - 347
Target Start/End: Complemental strand, 7802241 - 7801895
Alignment:
| Q |
2 |
attagaatcgggggtttttgtttttaaggtattcatgtttgggtttgtgaatagggg-ttgctgtttggtcatgttaatgaaacatgtggtcatgaattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7802241 |
attagaatcgggggtttttgtttttaaggtattcatgtttgggtttgtgaatagggggttgctgtttggtcatgttaatgaaacatgtggtcatgaattc |
7802142 |
T |
 |
| Q |
101 |
tcagttacccttgttgtattgtgcaaagaattgtatgcgactggcttctttgcctgttttcagaagacagcggttttttataagatctcttggaggtagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7802141 |
tcagttacccttgttgtattgtgcaaagaattgtatgcgactggcttcttcgcctgttttcagaagacagcggtttttgataagatctcttggaggtagc |
7802042 |
T |
 |
| Q |
201 |
attgattatcataccaattgtagttctggaaaaatgcagtctgttgaggttgatgctcagagggttattagagaaattactcctgtcctagatcgaagta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7802041 |
attgattatcataccaattgtagttctggaaaaatgcagtctgttgaggttgatgctgagagggttattagagaaattactcctgtcctagatcgaagca |
7801942 |
T |
 |
| Q |
301 |
gacataaaggccaggcaggtacacaattcttgcaaatccatatcttc |
347 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801941 |
gacataaaggacaggcaggtacacaattcttgcaaatccatatcttc |
7801895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University