View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_38 (Length: 265)
Name: NF14178_high_38
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 118 - 158
Target Start/End: Complemental strand, 35320846 - 35320806
Alignment:
| Q |
118 |
aaagttgatgaaaaatttagatgtggtttagctatattcac |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35320846 |
aaagttgatgaaaaatttagatgtggtttagctatattcac |
35320806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 215 - 250
Target Start/End: Complemental strand, 35320770 - 35320735
Alignment:
| Q |
215 |
tcttgaattgacatagagatttaaacacacatatct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
35320770 |
tcttgaattgacatagagatttaaacacacatatct |
35320735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University