View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_39 (Length: 265)
Name: NF14178_high_39
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 108 - 259
Target Start/End: Original strand, 39262551 - 39262692
Alignment:
| Q |
108 |
aaaccacaatgtgaacaaacatgttaattatatctagaaagttccctatacatgtcatttttgtagcacacaaagtagcagacaaaattggattaattgc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39262551 |
aaaccacaatgtgaacaaacatgttaattatatctagaaagttccctatacata----------agcacacaaagtagcagacaaaattggattaattgc |
39262640 |
T |
 |
| Q |
208 |
ttttgtttcattctttttctttggccctgattgttgttatcgttgttgattg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39262641 |
ttttgtttcattctttttctttggccctgattgttgttatcgttgttgattg |
39262692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 26 - 113
Target Start/End: Original strand, 39262439 - 39262526
Alignment:
| Q |
26 |
agagaactgatacctgtagagagctctttaatctttatttactacttgtaagattcttttacaacttgtcttcaacttgaagaaacca |
113 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39262439 |
agagaactaatacctgtagagagctctttaatctttatttactacttgtaagattcttttacaacttgtcttcaacttgaagaaacca |
39262526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University