View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_40 (Length: 265)
Name: NF14178_high_40
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 25115938 - 25115799
Alignment:
| Q |
1 |
tgatactcatgtgatcctattttgtgcatttatttatcactaaatagcttggaatattgcacaattgttattgtaccaattattagctttgaatcaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25115938 |
tgatactcatgtgatcctattttgtgcatttatttatcactaaatagcttggaatattacacaattgttattgtaccaattattagctttgaatcaatta |
25115839 |
T |
|
| Q |
101 |
ttgttgttaacctaattagaattcacctaaatacaacttt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25115838 |
ttgttgttaacctaattagaattcacctaaatacaacttt |
25115799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 150 - 209
Target Start/End: Complemental strand, 25115665 - 25115607
Alignment:
| Q |
150 |
aaaaccgttaaaatacttgtttatcatgttttagttttatttattttaaacatataaaaa |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25115665 |
aaaaccgttaaaatacttttttatcatgttt-agttttatttattttaaacatataaaaa |
25115607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University