View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_43 (Length: 254)
Name: NF14178_high_43
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_43 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 23768058 - 23768297
Alignment:
| Q |
15 |
cataggactactaacaactaatgattacatatcacacacaagatgtgagtcactgattgctcattcctcttcccttcatcacatatctccttagacctgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23768058 |
cataggactactaacaactaatgattacatatcacacacatgatgtgagtcactgattgctcattcctcttcccttcatcacatatctccttagacctgg |
23768157 |
T |
|
| Q |
115 |
tatatgaacattagtgatataatctttccaatctatgccttttacatcaaatctaaactccctcttttcttcttcagacatcatttctatcaatctttgt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23768158 |
tatatgaacattagtgatataatctttccaatctatgccttttacatcaaatctaaactccctcttttcttcttcagacatcatttctatcaatctttgt |
23768257 |
T |
|
| Q |
215 |
gtattactgttgtcaaacctgcatcacatttatttgtttc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23768258 |
gtattactgttgtcaaacctgcatcacatttatttgtttc |
23768297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University