View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_44 (Length: 243)
Name: NF14178_high_44
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 17106548 - 17106759
Alignment:
| Q |
19 |
tttcgaactaaactcgatgggaatttgctgatgaaattaaacaatagtttgatttccatcaatgctgttgttgaatatgctgagcagcagcagatcagaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106548 |
tttcgaactaaactcgatgggaatttgctgatgaaattaaacaatagtttgatttccatcaatgctgttgttgaatatgctgagcagcagcagatcagaa |
17106647 |
T |
 |
| Q |
119 |
gatctactgtgaggacatggatttgtaatgtcaaagatgctataatggatgctgaggatgttcttgatgaaatctacatacagaatttgaagtccaagct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106648 |
gatctactgtgaggacatggatttgtaatgtcaaagatgctataatggatgctgaggatgttcttgatgaaatctacatacagaatttgaagtccaagct |
17106747 |
T |
 |
| Q |
219 |
tccttttacttc |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17106748 |
tccttttacttc |
17106759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University