View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_45 (Length: 240)
Name: NF14178_high_45
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_45 |
 | |
|
| [»] scaffold0450 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0450 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 218
Target Start/End: Complemental strand, 12505 - 12305
Alignment:
| Q |
19 |
taggatcgttggacaagtaaattttgctaggtgaaactgcaatttactgacttgtatgaaaatagatgtaaatttagtttagacttaacctttacgaact |
118 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12505 |
taggatcgctcgacaagtagattttgctaggtgaaactgcaatttactgacttgtatgaaaatagatgtaaatttagtttagacttaacctttacgaact |
12406 |
T |
|
| Q |
119 |
ttagactcggatgtttttagagagtgagagaacacatgagaggatactttcaccattgaagagcattgggaac-ttatatccaaagttgagatgattccc |
217 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
12405 |
ttagactcagttgtttttagagagtgagagaacacatgagaggatactttcaccattgaagagcattgggaactttatatttaaaattgagatgattccc |
12306 |
T |
|
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
12305 |
t |
12305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University