View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_50 (Length: 231)
Name: NF14178_high_50
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 17 - 220
Target Start/End: Complemental strand, 15482206 - 15482003
Alignment:
| Q |
17 |
cacaataatcaatgtatattattagcagcagaaatttcagaatataacgtttcttgaagtgggtagaaaagttattccagaggttaattttcataataat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15482206 |
cacaataatcaatgtatattattagcagcagaaatttcagaatataacgtttcttgaagtgggtcgaaaagttattccagaggttaattttcataataat |
15482107 |
T |
 |
| Q |
117 |
gatgcatatattgcatgaatatacgttggtaccaccaagtagtatactgtacaattggactcatgcaaatataagacaatatttgtgatagctctacagt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15482106 |
gatgcatatattgcatgaatatacgttggtaccaccaagtagtatactgtataattgggctcatgcaaatataagacaatatttgtgatagctctacagt |
15482007 |
T |
 |
| Q |
217 |
tcat |
220 |
Q |
| |
|
|||| |
|
|
| T |
15482006 |
tcat |
15482003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University