View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14178_high_62 (Length: 201)

Name: NF14178_high_62
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14178_high_62
NF14178_high_62
[»] chr5 (1 HSPs)
chr5 (21-181)||(14526929-14527089)


Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 21 - 181
Target Start/End: Original strand, 14526929 - 14527089
Alignment:
21 acacaggcatctttgttccgaattttgttgcgactatggagaagattagcgagcagatgcgcagtaccggcttcggcacagcagttacagggacaggacc 120  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14526929 acacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagcagatgcgcagtaccggcttcggcacagcagttacagggacaggacc 14527028  T
121 tgatgataactatggcctagcacaatgctatggagatctttcattacttgactgtgtgttg 181  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
14527029 tgatgataactatggcctagcacaatgctatggatatctttcattacttgactgtgtgttg 14527089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University