View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_high_62 (Length: 201)
Name: NF14178_high_62
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_high_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 21 - 181
Target Start/End: Original strand, 14526929 - 14527089
Alignment:
| Q |
21 |
acacaggcatctttgttccgaattttgttgcgactatggagaagattagcgagcagatgcgcagtaccggcttcggcacagcagttacagggacaggacc |
120 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526929 |
acacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagcagatgcgcagtaccggcttcggcacagcagttacagggacaggacc |
14527028 |
T |
 |
| Q |
121 |
tgatgataactatggcctagcacaatgctatggagatctttcattacttgactgtgtgttg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14527029 |
tgatgataactatggcctagcacaatgctatggatatctttcattacttgactgtgtgttg |
14527089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University