View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_18 (Length: 418)
Name: NF14178_low_18
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 401
Target Start/End: Complemental strand, 22104526 - 22104126
Alignment:
| Q |
1 |
ccgccttgaaaagttccatagcatcaccttcgacacctggatgcaaaacaacattgtctccacccaaagaaataagcttgaaatccacaaactccgcatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
22104526 |
ccgccttgaaaagttccatagcatcaccttcgacacccggatgcaaaacaacattgtcttcacccaaagaaataagcttgaaatccacaaaccccacatc |
22104427 |
T |
 |
| Q |
101 |
aacgaaagcttgttgaacaatagacaagcaaaagtcattttttagtcttgctaaaatactcttggaggcccaagtaatgtcatctgtgaacggcatgaat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22104426 |
aacgaaagcttgttgaacaatatacaagcaaaagtcatttttaagtcttgctaaaatactcttggatgcccaagtaatgtcatctgtgaacggcatgaat |
22104327 |
T |
 |
| Q |
201 |
ttacacatcactttcttttcaacatcagcgccattaactagctccttcaccatcactttctttgaatttatacatcaatctattgggaaaattggtaatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
22104326 |
ttacacatcactttcttttcaacatcagcgccattaactagctccttcaccatcactttctttgaatttatacatcaatctattaggaaaatttgtaatg |
22104227 |
T |
 |
| Q |
301 |
taatacacagcagatacctgagttgacactgctggagcgttgccactcttatcttcagcagttgtgatttttgacagttttgagcctatgcctgcattgc |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22104226 |
taatacacagcagatacctgagttgacactgctggagcgttgccactctcatcttcagcagttgtggtttttgacagttttgagcctatgcctgcattgc |
22104127 |
T |
 |
| Q |
401 |
t |
401 |
Q |
| |
|
| |
|
|
| T |
22104126 |
t |
22104126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University