View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_32 (Length: 326)
Name: NF14178_low_32
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 2 - 312
Target Start/End: Complemental strand, 54115035 - 54114725
Alignment:
| Q |
2 |
gagtgatatgaacatcaccgtttccaggcatatctacgatattcttcttcgccttcaccttcaatagtcgctcaagtatactcacaagtgtcggcaccgt |
101 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54115035 |
gagtgaaaggaacatcaccgtttccaggcatatctacgatattcttcttcgccttcaccttcaatagtcgctcaagtatactcacaagtgtcggcaccgt |
54114936 |
T |
 |
| Q |
102 |
caccggcgaagtattccccagattaaagatccgatacggtgctgctccacgtttcttcccacccgatccagtactcttaccagaagtatccaatgatcca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54114935 |
caccggcgaagtattccccagattaaagatccgatacggtgctgctccacgtttcttcccacctgatccagtactcttaccagaagtatccaatgatcca |
54114836 |
T |
 |
| Q |
202 |
acacatcccttcactatatcatcaatgtaggtgaagtcacgtgacagatcaacccggttcttaccccgataaaccgtaatcagttttccctgaagcatat |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54114835 |
acacatcccttcactatatcatcaatgtaggtgaagtcacgtgacagatcaacccggttcttaccccgataaaccgtaatcggttttccctgaagcatat |
54114736 |
T |
 |
| Q |
302 |
ttcgagtgaaa |
312 |
Q |
| |
|
||| ||||||| |
|
|
| T |
54114735 |
ttctagtgaaa |
54114725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University