View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_35 (Length: 313)
Name: NF14178_low_35
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 27 - 307
Target Start/End: Original strand, 48114963 - 48115243
Alignment:
| Q |
27 |
tgaaccgtgaattgagtgatctgatagtagtaatatgataacaaaggcggtggctatccaccacttatggactaaacatctacaacgttgtatgattggt |
126 |
Q |
| |
|
|||||||| | || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48114963 |
tgaaccgtaatttaagtgatcagatagtagtaatatgataacaaaggcggtggctatccaccacttatggactaaacatctcaaacgttgtatgattggt |
48115062 |
T |
 |
| Q |
127 |
tcgataatcgtgaactgaacggattttgaataaagctcgatattgaacctatctcaacttttacaaaaacctaaatgtaaaatgtgaattcttcttttct |
226 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| || |
|
|
| T |
48115063 |
tcgataatcgtgaattaaacggattttgaataaagctcgatattgaacctatctcaacttttacaaaaacctacatgtaaaatgagaattcttctttgct |
48115162 |
T |
 |
| Q |
227 |
tccatactcttattttcatgtcctatcttattcaatgtgtttctcttaactgttatataaaacatcttacttttcttctca |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48115163 |
tccatactcttattttcatgtcctatcttattcaatgtgtttctcttaactgttatataaaacatcttacttttcttctca |
48115243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University