View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_47 (Length: 254)
Name: NF14178_low_47
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 39503337 - 39503113
Alignment:
| Q |
13 |
agcagagattgtgtcagaaccactaggagttgtgttgatcatatcaacatggaactttcctatgtgtatgtagaacattttcatctttcagacattctaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39503337 |
agcagagattgtgtcagaaccactaggagttgtgttgatcatatcaacatggaactttcctatgtgtatgtagaacatgttcatctttcagacattctaa |
39503238 |
T |
|
| Q |
113 |
attgcatttggttataatggagaacaatttttctccatatcattcaccactgtcatgtagcatatatatagattaatgtctgaaatcttggaactatagt |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39503237 |
attgcatttggttataacggagaacaatttttctccatatcattcaccactgtcatgtagcatatatatagattaatgtctgaaatcttggaactatagt |
39503138 |
T |
|
| Q |
213 |
tcattccactcaaatagaatttcac |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39503137 |
tcattccactcaaatagaatttcac |
39503113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University