View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_52 (Length: 234)
Name: NF14178_low_52
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 29942305 - 29942105
Alignment:
| Q |
20 |
aagggcaaactttgtaaatnnnnnnngtattctcacctactctatatgagaaatgtcctaatgcttgaataaaaggcatggactcaatatcacctgcatc |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29942305 |
aagggcaaactttgtaaataaaaaaagtattctcacctactctatatgagaaatgtcctaatgcttgaataaaaggcatggactcaatatcacctgcatc |
29942206 |
T |
|
| Q |
120 |
cagaagaatttaaattcaaattataaaacaatagaaactaacaatccatctaattctaaccatgaagaagcctgaggaatgttttcaagattgtacctat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29942205 |
cagaagaatttaaattcaaattataaaacaatagaaactaacaatccatctaattctaaccatgaagaagcctgaggaatgttttcaagattgtacctat |
29942106 |
T |
|
| Q |
220 |
g |
220 |
Q |
| |
|
| |
|
|
| T |
29942105 |
g |
29942105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University