View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_54 (Length: 233)
Name: NF14178_low_54
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 72 - 218
Target Start/End: Original strand, 39181166 - 39181312
Alignment:
| Q |
72 |
ctatttggtaaaatttatatcattctattatcaagtcccttatgtattgtgtttatttatgacataattttttagcaacctgttaaatataattcnnnnn |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
39181166 |
ctatttggtaaaatttatatcattctattatcaagtcccttatgtattgtgtttatttatgacataattttttagcaacctattaaatataattcttttt |
39181265 |
T |
|
| Q |
172 |
nngggagttgccttatcatggatttgggcatattacattgtcgaaga |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39181266 |
ttgggagttgtcttatcatggatttgggcatattacattgtcgaaga |
39181312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 159
Target Start/End: Original strand, 428939 - 429058
Alignment:
| Q |
39 |
caagtctttgtatttgggggatattagttcaaactatttggtaaaatttatatcattctattatcaagtcccttatgtattgtgtttatttatgacataa |
138 |
Q |
| |
|
|||||||||||||| || ||||||||||| | ||||||||||||| || |||||||||| ||| | |||||||| ||| |||||||||||| ||||| |
|
|
| T |
428939 |
caagtctttgtattaggaggatattagttttagctatttggtaaaacttctatcattctaacatc-atacccttatgcattatgtttatttatggcataa |
429037 |
T |
|
| Q |
139 |
ttttttagcaacctgttaaat |
159 |
Q |
| |
|
| |||||||||||| |||||| |
|
|
| T |
429038 |
tattttagcaacctattaaat |
429058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University