View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_56 (Length: 230)
Name: NF14178_low_56
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 13 - 157
Target Start/End: Complemental strand, 7801917 - 7801773
Alignment:
| Q |
13 |
aattcttgcaaatccatatcttcaannnnnnncattaagtggtgatgatgatgtgccttctttctgtcattccatgtgtgctagccttttcatagtagct |
112 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801917 |
aattcttgcaaatccatatcttcaatttttttcaataagtggtgatgatgatgtgccttctttctgtcattccatgtgtgctagccttttcatagtagct |
7801818 |
T |
|
| Q |
113 |
atggtgttaattataatcacaatgcaacctcaatctgggctgcag |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801817 |
atggtgttaattataatcacaatgcaacctcaatctgggctgcag |
7801773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 169 - 211
Target Start/End: Complemental strand, 7801750 - 7801708
Alignment:
| Q |
169 |
atgttggtgaaaccacaatgcaaccatgattaagggtgcaatt |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7801750 |
atgttggtgaaacctcaatgcaaccatgattaagggcgcaatt |
7801708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University