View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14178_low_58 (Length: 221)
Name: NF14178_low_58
Description: NF14178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14178_low_58 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 53267761 - 53267982
Alignment:
| Q |
1 |
tgttacaggcttacaggtagatttaaatattattgataagcaacaaaatatcatgatctttcatgtaggtgccataaatagtcattacctacttc----c |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
53267761 |
tgttacaggcttacaggtagatttaaatatt---gataagcaacaaaatatcatgatctttcatgtaggtgccataaatagtcattacctacttccttcc |
53267857 |
T |
 |
| Q |
97 |
attgaacatattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttctaatttaatcga |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267858 |
attgaacacattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttctaatttaatcga |
53267957 |
T |
 |
| Q |
197 |
agatttttctaaacacatttgttgc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53267958 |
agatttttctaaacacatttgttgc |
53267982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University