View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14179_low_4 (Length: 211)
Name: NF14179_low_4
Description: NF14179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14179_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 17725647 - 17725465
Alignment:
| Q |
14 |
aatataaaattaatttcaaacttatagtgtgtatagaatagaacattgatttgttattatgccttaatattgaacaggtattggaggctttctataccca |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17725647 |
aatataaaattaatgtcaaacttatagtgtgtatagaatagaacattgatttgttattatgccttaatattgaacaggtattggaggctttctataccca |
17725548 |
T |
 |
| Q |
114 |
ttggagaagatactgatcacccacttgtgaatccatttggaccaagaagtaagagtcttgaggaaattgatcttgacccaatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17725547 |
ttggagaagatactgatcacccacttgtgaatccatttggaccaagaagtaagagtcttgaggaaattgatcttgacccaatt |
17725465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University