View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1417_low_10 (Length: 226)
Name: NF1417_low_10
Description: NF1417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1417_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 205
Target Start/End: Original strand, 30135963 - 30136169
Alignment:
| Q |
2 |
caatcccattaaccttgcaactacaccagaa---gaagaagaagaaattatagttcttgtagtagtaggagtgttagtcttaaatttttgaactttttca |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30135963 |
caatcccattaaccttgcaactacaccagaagaagaagaagaagaaattatagttcttgtagtagtaggagtgttagtcttaaatttttgaactttttca |
30136062 |
T |
 |
| Q |
99 |
cttacaatgaactttgaatgaaactctctaatcctatgaaaaatggttgtgaaacaccctgcagcaacagtttttgagctgcaaaatgttgagtcaaagc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30136063 |
cttacaatgaactttgaatgaaactctctaatcctatgaaaaatggttgtgaaacaccctgcagcaacagtttttgagctgcaaaatgttgagtcaaagc |
30136162 |
T |
 |
| Q |
199 |
taaagtt |
205 |
Q |
| |
|
||||||| |
|
|
| T |
30136163 |
taaagtt |
30136169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University