View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1417_low_11 (Length: 207)
Name: NF1417_low_11
Description: NF1417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1417_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 115 - 199
Target Start/End: Original strand, 49288086 - 49288170
Alignment:
| Q |
115 |
tggaaaacgaaaatggatatgagagaacaaatattgacgagttttttcaatcaggaaacaacaacacaatagcaacattcatctc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49288086 |
tggaaaacgaaaatggatatgagagaacaaatattgacgagttttttcaatcaggaaacaacaacacaccagcaacattcatctc |
49288170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 115 - 178
Target Start/End: Complemental strand, 4385849 - 4385786
Alignment:
| Q |
115 |
tggaaaacgaaaatggatatgagagaacaaatattgacgagttttttcaatcaggaaacaacaa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4385849 |
tggaaaacgaaaatggatatgagagaacaaatattgacgagttttttcaatcaggaaacaacaa |
4385786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 115 - 165
Target Start/End: Complemental strand, 35770896 - 35770846
Alignment:
| Q |
115 |
tggaaaacgaaaatggatatgagagaacaaatattgacgagttttttcaat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35770896 |
tggaaaacgaaaatggatatgagagaacaaatattgacgagttttttcaat |
35770846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University