View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1417_low_9 (Length: 236)

Name: NF1417_low_9
Description: NF1417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1417_low_9
NF1417_low_9
[»] chr5 (1 HSPs)
chr5 (1-142)||(30135838-30135978)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 30135978 - 30135838
Alignment:
1 aaggttaatgggattggattcaatggaagaagagaaagtttctgaatcaaaaccaagttcacttacacattgcaagtcattgaactatgtaccacaagct 100  Q
    |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||    
30135978 aaggttaatgggattg-attcaatggaagaagataaagtttctgaatcaaaaccaagttcacctacacattgcaagtcattgaactatgtgccacaagct 30135880  T
101 tttcatttgcttgaaaatgagaactttttggtgtttagcttt 142  Q
    ||||||||||||||||||||||||||||||||||||||||||    
30135879 tttcatttgcttgaaaatgagaactttttggtgtttagcttt 30135838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University