View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1417_low_9 (Length: 236)
Name: NF1417_low_9
Description: NF1417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1417_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 30135978 - 30135838
Alignment:
| Q |
1 |
aaggttaatgggattggattcaatggaagaagagaaagtttctgaatcaaaaccaagttcacttacacattgcaagtcattgaactatgtaccacaagct |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30135978 |
aaggttaatgggattg-attcaatggaagaagataaagtttctgaatcaaaaccaagttcacctacacattgcaagtcattgaactatgtgccacaagct |
30135880 |
T |
 |
| Q |
101 |
tttcatttgcttgaaaatgagaactttttggtgtttagcttt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30135879 |
tttcatttgcttgaaaatgagaactttttggtgtttagcttt |
30135838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University