View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14181_low_11 (Length: 334)
Name: NF14181_low_11
Description: NF14181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14181_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 61 - 317
Target Start/End: Complemental strand, 24095969 - 24095713
Alignment:
| Q |
61 |
gttgggtcatgcagacatgtatggtatgatattggaatcaaacaaaccaatatcaagcactcaaaaaacaaatctaggattgcatgttgttcaacatgca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24095969 |
gttgggtcatgcagacatgtatggtatgatattggaatcaaacaaaccaacatcaagcactcaaaaaacaaatctaggattgcatgttgttcaacatgca |
24095870 |
T |
 |
| Q |
161 |
aaggtatcaaagagatcaaggacagtttatggaggagccaataacgtgaagagtccacataagggaaaaaatagtgcaagcaccaattcaatcaaatctt |
260 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24095869 |
aaggtgtcaaagagagcaaggacagtttatggaggagctaataacgtgaagagtccacataagggaaaaaatagtgcaagcaccaattcaatcaaatctt |
24095770 |
T |
 |
| Q |
261 |
catctttattcatggcttcattaagccttccagcaatgattctggttggtggcttct |
317 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24095769 |
catctttattgatggcttcattaagccttccagcaatgattctggttggtggcttct |
24095713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University