View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14181_low_19 (Length: 225)
Name: NF14181_low_19
Description: NF14181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14181_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 37542697 - 37542829
Alignment:
| Q |
18 |
gattcttcttgtggtaacccgtggtcccgttgcagtttatggttttcattttctggccatttatgaattgtggatcgaagctaacttatcgggcacgcac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37542697 |
gattcttcttgtggtaacccgtggtcccgttgcagtttatggttttcattttctggccatttatgaattgtggatcaaagctaacttatcgggcacgcac |
37542796 |
T |
 |
| Q |
118 |
ggtcactgaaaagattctaatgtcagcccatca |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37542797 |
ggtcactgaaaagattctaatgtcagcccatca |
37542829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University