View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14181_low_19 (Length: 225)

Name: NF14181_low_19
Description: NF14181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14181_low_19
NF14181_low_19
[»] chr8 (1 HSPs)
chr8 (18-150)||(37542697-37542829)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 18 - 150
Target Start/End: Original strand, 37542697 - 37542829
Alignment:
18 gattcttcttgtggtaacccgtggtcccgttgcagtttatggttttcattttctggccatttatgaattgtggatcgaagctaacttatcgggcacgcac 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
37542697 gattcttcttgtggtaacccgtggtcccgttgcagtttatggttttcattttctggccatttatgaattgtggatcaaagctaacttatcgggcacgcac 37542796  T
118 ggtcactgaaaagattctaatgtcagcccatca 150  Q
    |||||||||||||||||||||||||||||||||    
37542797 ggtcactgaaaagattctaatgtcagcccatca 37542829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University