View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14182_low_9 (Length: 230)
Name: NF14182_low_9
Description: NF14182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14182_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 16 - 116
Target Start/End: Original strand, 34360777 - 34360878
Alignment:
| Q |
16 |
caacccacttacgccactcctgccgcatacagtttctcaattcccgctataccaagactgatcctgtt-aacaattatgttaaccatgcatttcagggta |
114 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34360777 |
caacccacttaaaccactcccgccgcatacagtttctcaattcccgctatacaaagactgatcctgttaaacaattatgttaaccatgcatttcagggta |
34360876 |
T |
|
| Q |
115 |
ta |
116 |
Q |
| |
|
|| |
|
|
| T |
34360877 |
ta |
34360878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 84 - 131
Target Start/End: Original strand, 25291387 - 25291434
Alignment:
| Q |
84 |
aacaattatgttaaccatgcatttcagggtatagctgttgaaattcat |
131 |
Q |
| |
|
||||||||||||||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
25291387 |
aacaattatgttaactatgtatttcatggtatagctgttgaaattcat |
25291434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University