View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14183_low_6 (Length: 303)
Name: NF14183_low_6
Description: NF14183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14183_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 16 - 266
Target Start/End: Complemental strand, 11928546 - 11928295
Alignment:
| Q |
16 |
catgtacttgtatggaggtgggggataattttacagactattgtttgtgttttgagttagaagttctttggtgaagattgtttggaa-aatttttgggtt |
114 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
11928546 |
catgtacttgtatggaggtggggcataaattttcagactattgtttgtgttttgagttagaagtgctttggtgaagattgtttggaattttttttgggta |
11928447 |
T |
 |
| Q |
115 |
tgttcagtgtttctttagtgtttttactttgtactactctatattcgagccttcatcatgttgtttttgtggctctaaatcatctggttttcgttttggt |
214 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||| | | ||||| ||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11928446 |
tgttaagtgtttctttagtgtttttactttgcactactttgtgcccgagctttcatca--ttgtttttgtggctctaaatcatctggctttcgttttggt |
11928349 |
T |
 |
| Q |
215 |
atttaacatttca--ttctttagtatgtgagtccttctgtatgtttctacataa |
266 |
Q |
| |
|
||| || |||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11928348 |
attcaaaatttcattttttttagtatgtgagtccttctgtatgtttctacataa |
11928295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University