View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14183_low_7 (Length: 232)
Name: NF14183_low_7
Description: NF14183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14183_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 51 - 226
Target Start/End: Original strand, 38933916 - 38934088
Alignment:
| Q |
51 |
atgcttgccatgaaactatgcattgttttttaacctattgcaatgtttatgtgttggcaattgctttgacattttagcttaaacatgttccgtttaagaa |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
38933916 |
atgcttgccatgaaactatgcattgttt---aacctattgcaatgtttatgtgttggcaattgctttgaccttttagcttaaacatgttccatttaagaa |
38934012 |
T |
|
| Q |
151 |
ttcatggtggcttattttcctatacttgcttttagcttaagtgttgtatgcatttttgttttatgatgatgatgtc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38934013 |
ttcatggtggcttattttcctatacttgcttttagcttaagtgttatatgcatttttgttttatgatgatgatgtc |
38934088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 38933854 - 38933887
Alignment:
| Q |
16 |
actaacttgataactctcttgtcaaatatgaagt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38933854 |
actaacttgataactctcttgtcaaatatgaagt |
38933887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University