View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14184_high_16 (Length: 219)
Name: NF14184_high_16
Description: NF14184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14184_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 14631419 - 14631236
Alignment:
| Q |
11 |
ttattctaatgttagtctatattgaagaagttttataaccatgaagacatttgtaatcaagaaaacacgaattgtgtttccaaaataaaacttcagacca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14631419 |
ttattctaatgttagtctatattgaagaagttttataaccatgaagacatttgtaatcaagaaagcacgaattgtgtttccaaaataaaacttcagacca |
14631320 |
T |
 |
| Q |
111 |
attgataagacaaacaatgtttcaaatttcaaattcactcacaatgattgtcgaatattctaaactttcaaagctcgggtagat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14631319 |
attgataagacaaacaatgtttcaaatttcaaattcactcacaatgattgtcgaatattctaaactttcaaagctagggtagat |
14631236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University