View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14184_low_14 (Length: 245)
Name: NF14184_low_14
Description: NF14184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14184_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 13445915 - 13445690
Alignment:
| Q |
1 |
aaataattcatattgaacctcataactttaacttacatactaatattttacacatttaatttaaatccactcaaagtatcgtcagttgctgaagtaacca |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13445915 |
aaataattcatattgaacctcgcaactttaacttacatactaatattttacacatttaatttaaatccactcaaagtatcgtcagttgctgaagtaacca |
13445816 |
T |
|
| Q |
101 |
tgatgccaccttgttaaacttgtacacttcacgacaccatcacaatggaaaaacttgtcgaggcataatttatcgacctgaaatcctaatttcccagaaa |
200 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13445815 |
tgacgccaccttgttaaactcgtacacttcacgacaccatcacaatggaaaaacttgtcgaggcataatttatcgacctgaaatcctaatttcccagaaa |
13445716 |
T |
|
| Q |
201 |
tattagtcttaccctttattccaccc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
13445715 |
tattagtcttaccctttattccaccc |
13445690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University