View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14184_low_19 (Length: 211)
Name: NF14184_low_19
Description: NF14184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14184_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 78 - 199
Target Start/End: Original strand, 26564218 - 26564339
Alignment:
| Q |
78 |
ggattgtgagctaagcacttttaagtgcttatgttgttctagactcaaaaagttaaaaggtcaaaattctctttagtttataggtttttctcatagggtg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26564218 |
ggattgtgagctaagcacttttaagtgcttatgttgttctagactcaaaaagttaaaaggtcgaaattctctatagtttataggtttttctcatagggtg |
26564317 |
T |
|
| Q |
178 |
caaaaactttgtcacatgtgat |
199 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
26564318 |
caaaaactttgtcacatatgat |
26564339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University