View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14185_high_11 (Length: 257)
Name: NF14185_high_11
Description: NF14185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14185_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 6227390 - 6227621
Alignment:
| Q |
1 |
ttagtggccgttttgcctttgttaactttgccaccaaggaagctgctcagagtgctattgaaagactcaatgggatcgactaccacaatttcatccttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227390 |
ttagtggccgttttgcctttgttaactttgccaccaaggaagctgctcagagtgctattgaaagactcaatgggatcgactaccacaatttcatccttag |
6227489 |
T |
 |
| Q |
101 |
agttgaatgttccaccccaacaacaacctaaaagtata------------tggtttatgcatctgtgtacatgtttacgttaaatgatagttgtttcttc |
188 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6227490 |
agttgaatggtccaccccaacaacaacctaaaagtatacatttccggtactggtttatgcatctgtg----tgtttacgttaaatgatagttgtttcttc |
6227585 |
T |
 |
| Q |
189 |
tttttgcttgcatctgtactatggatccctatgtac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6227586 |
tttttgcttgcatctgtactatggatccttatgtac |
6227621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University