View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14185_high_15 (Length: 236)
Name: NF14185_high_15
Description: NF14185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14185_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 45143409 - 45143621
Alignment:
| Q |
10 |
gcataggtgaatttaaatcttgtcatcattgacatataatggagaagttgtaatggtatagtgaaacaagtactggaggaaaggtcatttgggagttgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45143409 |
gcataggtgaatttaaatcttgtcatcattgacatataatggagaagttgtaatggtatagtgaaaaaagtactggaggaaaggtcatttgggagttgaa |
45143508 |
T |
|
| Q |
110 |
aattaagaaacaatgagttttcaataatttaaattttcagtacatgaattaagttagaaaaattaatgtgacactccatgtcttgcaattttcataggta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45143509 |
aattaagaaacaatgagttttcaataatttaaattttcagtacatgaattaagttagaaaaattaatgtgacactccatgtcttgcaattttcataggta |
45143608 |
T |
|
| Q |
210 |
ggatatattatac |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45143609 |
ggatatattatac |
45143621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University