View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14185_high_9 (Length: 265)
Name: NF14185_high_9
Description: NF14185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14185_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 7947193 - 7947437
Alignment:
| Q |
1 |
actatatttatacttgtgattatgttttttgatgatttacataattgctttgattccttttatgcaaaatattatgctgtgtggaactggaacatgtcta |
100 |
Q |
| |
|
|||||||| ||||||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7947193 |
actatattattacttgttattatgatttttgatgatttacataattgcttttattccttttatgcaaaatattatgctgtgtggaactggaacatgtcta |
7947292 |
T |
 |
| Q |
101 |
taatattatatt---taccactttaattatgagaaaggttgaaaaactagctcttataatattataaaacgtatgtgaaattcaacaatatgtgacatcg |
197 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7947293 |
taatattatattatttaccactttaattatgagaaaggttgaaaaactagctcttataatattataaaacgtatgtgaaatttaacaatatgtgacatcg |
7947392 |
T |
 |
| Q |
198 |
gttgttatgggagtctttagttaattgatctttaagaaacaaacttgtataa |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7947393 |
gttgttatggg-------agttaattgatctttaagaaacaaacttgtataa |
7947437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University